DNA Sequencing

Sanger

• ddNTPs
• Chain terminating
• One lane per ddNTP, four rxns per sequence
• Polyacrylamide gel, 14"x17"
• Radiolabeled
• 100 base reads

Sanger F, Nicklen S and Coulson AR (1977) DNA sequencing with chain-terminating inhibitors Proc Natl Acad Sci USA 74: 5463-7.

Variations on Sanger

• Dye conjugated terminators
• One reaction per sequence, lane
• Polyacrylamide gel, 14"x17"
• 100 base reads

Variations on Sanger

• Dye conjugated terminators
• Capillary electrophoresis
• 600 bases
• Nine runs/twenty-four hours
• 5000 base calls per day

FASTQ

@This is a short sequence
		  

		GCATACCGCAGTCGACTCGTA
		  

		+
		  

		  !'))FGVHII[abacdbac(!

Quality scores, low to high

!"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~

Cock PJA, Fields CJ, Goto N, Heuer ML and Rice PM (2010) The Sanger FASTQ file format for sequences with quality scores, and the Solexa/Illumina FASTQ variants Nucleic Acids Res 38: 1767-71.