PS08
Local Alignment
Due 4 December, 2025
  1
Deborah the paleobiologist was out trekking in a cold and dark place when she discovered some frozen remains. Becoming very excited, she began to collect fragments from the area. Upon returning to her laboratory many months later, she was a bit confused by her record keeping of the event (it is a bit challenging to keep a good notebook when it is dark and you are excited). In particular, there are three samples that are most confusing. To solve the dilemma, Deborah isolated some mtDNA (it is closed circular DNA, just like a plasmid, very easy to isolate) and sequenced a small section of each. Those sequences are below. Using BLAST (-db nt), determine if Deborah's three fragments are likely from the same organism.
Sample 1:
AAAACAACTTCTGTCTATTCATAATACAAAAGGACTGTCATGATCTCTAATA
TTAATTACTCTAACTTTATTCATTGGTCTAACCAATCTACTAGGTCTATTAC
CCTATTCATTCGCTCCTACAGCACAACTAACCGTAAACTTAAGCATAGCAAT
CCCCCTATGGACTGGTACAGTTATCCTGGGCTTCCGATATAAAACTAAAATC
TCACTAGCCCATCTTCTCCCACAAGGAACACCTACATTCCTTATCCCTATAA
TTATTATTATCGAAACCATTAGTCTCCTCATTCGACCAGTCACTCTAGCGGT
TCGAC
Sample 2:
CCTTTACCCTGAGCTATACAAGCTAACAATACAAATCTGACACTCTTGATAT
CATTCATATTAATCATTCTCTTAGCTATTGGCCTAGCCTATGAATGACTCCA
AAAAGGCCTTGAATGAACTAAA
Sample 3:
TTTTCGGTAGATAAAGCAACCTTAAATCGATTCTTCGCCCTCCATTTTATTCT
TCCATTTACTATAATTGCACTAGCAGGAGTACACCTAACCTTCCTTCACGAAA
CAGGCTCAAATAACCCACTAGGCCTCACTTCAGACTCAGACAAAATCCCCTTT
CACCCGTACTATACCATCAAAGACTTCCTAGGACTACTTATCCTAATCCTATT
CCTTCTACTCTTAGCCCTACTATCTCCTGACATACTAGGAGACCCTGACAACT
ACATACCAGCTGATCCACTTAATACTCCCCTACACATCAAACCAGAGTGATAC
TTCCTCTTTGCTTACGCCATCCTACGATCTGTACCAAACAAACTAGGAGGCGT
CC
  2
The human Y chromosome (the short one) contains the TGIF2LY gene. And no, it's not the Thank Goodness It's Friday, Too Late Y'all gene, that's the Transforming Growth factor β Induced Factor homeobox 2 Like Y linked gene ... that mouthful is why the gene symbol is usually used. This gene, found on the maleness end of the Y chromosome, is a transcription factor from the homeobox family of transcription factors. It is suggested that this transcription factor regulates the expression of a similar gene on the X chromosome (see, those men can't even do gene expression on their own).
Design a pair of primers to amplify a 315 to 325 base pair product from the TGIF2LY gene. Please be sure that each of the primers in the pair has a melting temperature between 65 and 68 oC. Please report all the salient characteristic of your designed primers such as sequence, TM, percent GC and the size of the expected product. Here is a basic Primer3 input file to get you started. The Primer3 manual is available for reference.
When you're done designing a primer pair, check to see if the primer pair might amplify anything else in the human genome (-db human_genomic -word_size 7). Does it? Is it surprising? Explain.

Enter your student id number :
and select your file (6 mb max file size):


Last updated at 08:39:49 on 2025-12-04.
Page generated in 2 milliseconds.